Final Att-4d MHS Tech Guidance (2)

Attachment 4(d)
National HIV Surveillance System (NHSS)
OMB # 0920-0573

Supplemental Surveillance Activity 2: Molecular HIV Surveillance (MHS) Technical Guidance
Formerly known as VARHS (Variant, Atypical, and Resistant HIV Surveillance)

1

Technical Guidance for
HIV Surveillance Programs
Molecular HIV Surveillance (MHS)

HIV Incidence and Case Surveillance Branch
Atlanta, Georgia
Cleared by HICSB Management 10/15/2012

Notes

Cleared by HICSB Management 10/15/2012

CONTENTS — MOLECULAR HIV SURVEILLANCE (MHS)
Introduction
 Objectives
 Disease surveillance activity
General Concepts
 Antiretroviral therapy (ART)
 HIV drug resistance and transmitted drug resistance-associated mutations
 HIV genotypic resistance testing
 HIV-1 subtypes
Structural Requirements
 Policies and procedures
 Staffing needs
Process Standards
 Secure and confidential reporting of HIV surveillance data
 Collecting antiretroviral use history data for all newly diagnosed persons
 Reviewing state or local laws and regulations regarding the reporting of HIV nucleotide sequence
data
 Collaborating with laboratories performing HIV genotype testing
 Obtaining HIV nucleotide sequence data for all persons diagnosed
o Electronic laboratory-based reporting (ELR)
 Transmission with HIV case surveillance data
 Transmission through the National Electronic Disease Surveillance System
(NEDSS)
 Transmission using Secure File Transfer Protocol (SFTP)
o Non-ELR methods
o Electronic file formats
 Storing and validating HIV nucleotide sequence data
 Linking HIV nucleotide sequence data with case surveillance information
 Ongoing monitoring of data quality and evaluation of local data
 Preparing monthly data sets and transferring them to CDC
 Analyzing data, including transmitted drug resistance data
 Developing and disseminating data reports and presentations
Outcome Standards
References
Suggested Readings
Appendices
 CDC Exemption
 MHS data elements
 History and timeline of MHS
 Glossary of terms
 Acronyms

Cleared by HICSB Management 10/15/2012

Technical Guidance for HIV Surveillance Programs — Policies
and Procedures for Molecular HIV Surveillance (MHS)
INTRODUCTION
The Centers for Disease Control and Prevention (CDC) maintains the National HIV Surveillance System
and collects data on diagnoses of HIV infection for national, state, and local HIV program planning and
evaluation. As a component of this system, Molecular HIV Surveillance (MHS) ―formerly referred to as
Variant, Atypical, and Resistant HIV Surveillance (VARHS) ― monitors trends in HIV-1 drug resistance
and evaluates the genetic diversity of HIV-1 in the United States. Unless otherwise noted, all references to
HIV in this document refer to HIV-1 infection.

Objectives
The primary objectives of MHS are as follows:


Collect HIV nucleotide sequence data from laboratories that perform HIV genotype testing;



Estimate the prevalence of and monitor trends in HIV drug resistance mutations, including
transmitted drug resistance–associated mutations (TDRMs);



Monitor the distribution of HIV genetic subtypes and recombinants, including circulating
recombinant forms (CRFs) and unique recombinant forms (URFs);



Use molecular HIV data to describe patterns of HIV transmission; and



Disseminate the results of molecular HIV data analyses to assist HIV treatment, prevention, and
program planning and evaluation.

MHS provides a unique perspective about HIV disease in the United States. MHS activities include
applying an HIV drug resistance-associated mutation list, which was developed for public health
surveillance purposes, to identify factors associated with HIV drug resistance and genetic diversity at the
population level. MHS uses molecular epidemiology to help describe HIV transmission, clusters, and
diversification. MHS data have been referenced in the development of recommended first-line
antiretroviral drug regimens. MHS activities support the National HIV/AIDS Strategy goals of (1) reducing
new HIV infections through the potential use of nucleotide sequence data to determine duration of infection
and estimate incidence; (2) increasing access to care and improving health outcomes by using nucleotide
sequence data as a marker for linkage to and quality of care, and (3) reducing HIV-related disparities and
health inequities by using nucleotide sequence data to reveal transmission patterns and provide insight into
prevention.
Cleared by HICSB Management 10/15/2012

Disease Surveillance Activity
In 2004, CDC determined that the collection of HIV nucleotide sequence data as a part of the National HIV
Surveillance System was a non-research disease surveillance activity and that a review by the Institutional
Review Board, pursuant to Title 45 Code of Federal Regulations Section 46: Protection of Human Subjects,
was not required (Appendix A).

GENERAL CONCEPTS
Antiretroviral therapy (ART)
Current treatment of HIV disease has been designed and optimized for HIV-1 and includes five classes of
antiretroviral drugs (ARVs). These ARVs have been approved by the Food and Drug Administration
(FDA) for use in the treatment or prophylaxis of HIV infection and prevention of HIV replication at various
stages of its life cycle (Figure 1). They include the following:


Nucleoside reverse transcriptase inhibitors (NRTIs) and non-nucleoside reverse transcriptase
inhibitors (NNRTIs), which prevent the HIV reverse transcriptase (RT) from transcribing HIV
RNA to viral DNA;



Protease inhibitors (PIs), which prevent the maturation of HIV proteins by the HIV protease;



Integrase strand transfer inhibitors (INSTIs), which block the HIV integrase from integrating viral
DNA into the genome of host cells with CD4 receptors; and



Entry/fusion inhibitors (EIs), which prevent the HIV envelope (env) from binding to and allowing
the HIV genome to enter the human cell.
Figure 1. Map of HIV-1 Genome and ARV Targets

Cleared by HICSB Management 10/15/2012

Appropriately timed and consistent use of ARVs can suppress viral loads, which can lead to better health
outcomes and a much lower chance of passing HIV on to partners (1). Lists of ARVs and recommended
HIV treatment regimens are available at:
http://www.aidsinfo.nih.gov/ContentFiles/AdultandAdolescentGL.pdf.

HIV Drug Resistance and Transmitted Drug Resistance-associated Mutations
HIV has a rapid reproduction rate and a very high mutation rate. Because HIV lacks the mechanism to
correct mistakes that occur as it reproduces, HIV in an infected person exists as a set of related, but
non-identical viruses, some of which are intrinsically drug resistant even in the absence of ARV pressure
(i.e., contain polymorphisms). Expanded and suboptimal uses of ART have also contributed to the
emergence of drug-resistant strains of HIV, resulting in suboptimal virologic responses, treatment failures,
and transmission of drug-resistant strains of HIV. CDC estimates that one in six individuals newly
diagnosed with HIV infection and reported with nucleotide sequence data was infected with a strain that
contained TDRMs associated with at least one antiretroviral drug class (2).

HIV Genotype Testing
HIV genotype testing is used to detect the presence of mutations associated with antiretroviral drug
resistance. Standard HIV genotypic assays extract viral RNA from the blood plasma of an infected person
and amplify regions of the HIV genome targeted by ARVs, mainly the PR and RT genes of the pol region
(Figure 1). Other areas of the HIV genome, the integrase gene in the pol region and the envelope gene, can
also be tested for mutations associated with antiretroviral drug resistance. A nucleotide sequence of the
person’s viral isolate is translated into corresponding amino acids and compared to a “wild-type” reference
strain to identify mutations associated with drug resistance. A final report is generated that provides an
interpretation of the level of resistance detected and can be used by health providers in the clinical
management of patients.
HIV genotype testing is a part of the standard of care for persons infected with HIV. The U.S. Department
of Health and Human Services and the International Antiviral Society-USA (IAS-USA) recommend that
HIV genotype testing be performed at entry into care, prior to initiation of ART, and upon treatment failure
(3,4).

HIV-1 Subtypes
There are two types of HIV: HIV-1 and HIV-2. Most HIV infections in the United States and around the
world are caused by HIV-1. More than 90% of HIV-1 infections belong to Group M, of which at least 9
Cleared by HICSB Management 10/15/2012

genetically distinct subtypes (or clades) are known: A, B, C, D, F, G, H, J and K (Figure 2). There are also
"circulating recombinant forms" (CRFs) derived from the merging of different subtypes, “unique
recombinant forms” (URFs), and numerous unknown variants.
Figure 2. Genetic Diversity of HIV-1

Standard genotyping methods used to identify mutations associated with antiretroviral drug resistance can
also be used to distinguish between subtype B and non-B variants of HIV. Phylogenetic analyses are used
by CDC to classify potential non-B variants to the other subtypes, CRFs, and potential URFs.

STRUCTURAL REQUIREMENTS
Policies and Procedures
All persons diagnosed with HIV infection and all HIV-related laboratory test results (including, where
applicable, results from HIV genotype tests) should be reported to HIV surveillance programs as required
by local laws and regulations. Upon receipt, the local surveillance program should enter or import the
information into eHARS in accordance with the Technical Guidance for HIV Surveillance Programs, Vol.
I: Policies and Procedures. Because MHS is an extension of HIV case surveillance, MHS staff, in
collaboration with CDC, should expand on the existing infrastructure to collect the information needed to
achieve MHS objectives.

Before implementing MHS, local staff should consult with the assigned CDC epidemiologist and the CDC
MHS project officer about an implementation plan, a timeline for implementation, and the incorporation of
MHS policies and procedures into local guidance documents.
MHS-specific policies and procedures should include information related to the following elements:


Staff responsibilities and requirements, including collaboration with case surveillance

Cleared by HICSB Management 10/15/2012



Security and confidentiality



Collection of ARV use history data



Laws and regulations regarding the reporting of HIV nucleotide sequence data



Collection of HIV nucleotide sequence data from laboratories



Data management practices



Data transmissions to CDC



Local analysis and dissemination



Program evaluation

Staffing Needs
HIV case surveillance staff and MHS staff must collaborate to effectively integrate MHS into the local
HIV surveillance system and to implement MHS successfully. The number of staff needed to conduct
MHS activities at the local level depends on the phase of program implementation, HIV morbidity, and
resource availability, but will typically include a partial full-time employee (FTE) for MHS coordination
and a partial FTE for MHS data management.
MHS staff are expected to understand the local HIV surveillance system and MHS and work closely with
case surveillance staff, laboratory and clinical service providers, HIV surveillance coordinators in other
states, and CDC. MHS staff should also have expertise in three areas―programmatic, technical, and
scientific―and ensure that the following activities related to project coordination, surveillance and
epidemiology, and data management are conducted:
Programmatic: Project Coordination


Overall management of MHS and collaboration with other surveillance staff to ensure integration
of MHS into the local HIV surveillance system



Coordination of efforts to establish the regulatory authority to obtain HIV nucleotide sequence data
from laboratories



Development and implementation of MHS activities, including local MHS guidance, policies, and
procedures



Compliance of MHS activities with CDC and local security and confidentiality requirements



Collection of antiretroviral use history data for all new HIV diagnoses, including training of all data
collectors and timely and accurate entry of these data on the Testing and Treatment History
Document in eHARS

Cleared by HICSB Management 10/15/2012



Collaboration with laboratories to develop and implement procedures for the electronic transfer of
HIV nucleotide sequence data to the health department



Participation in CDC site visits, trainings, and workshops highlighting MHS activities as required



Continued monitoring of MHS activities to ensure that process and outcome standards are achieved

Technical: Data Management


Development, integration, and maintenance of data management systems for the receipt, storage,
processing, and analysis of MHS data



Development of processes to ensure that MHS meets or exceeds data quality outcome standards



Ongoing proficiency in Base SAS software and other locally-required data management/analysis
applications



Preparation of MHS data for local analysis and transmission to CDC

Scientific: Surveillance and Epidemiology


Analysis of HIV drug resistance and subtypes/CRFs in the jurisdiction



Development and dissemination of MHS data reports and publications

PROCESS STANDARDS
MHS activities involve the following general processes:


Secure and confidential reporting of HIV surveillance data



Collecting antiretroviral use history data for all persons newly diagnosed with HIV infection



Reviewing state or local HIV laws and regulations regarding the reporting of HIV nucleotide
sequence data



Collaborating with laboratories performing HIV genotype testing



Obtaining HIV nucleotide sequence data for all persons diagnosed



Storing and validating HIV nucleotide sequence data



Linking HIV nucleotide sequence data with case surveillance information



Ongoing monitoring of data quality and evaluation of local activities



Preparing monthly data sets and transferring them to CDC



Analyzing data, including transmitted drug resistance



Developing and disseminating data reports and presentations 

Cleared by HICSB Management 10/15/2012

Secure and confidential reporting of HIV surveillance data
The secure and confidential transfer of any HIV-related data, including HIV nucleotide sequence data, is of
utmost importance. Areas should review existing state and local policies on maintaining patient
confidentiality and develop specific steps that will be taken to secure the data. These standard operating
procedures should be reviewed and approved by the ORP and should be consistent with the guidelines and
standards specified in Data Security and Confidentiality Guidelines for HIV, Viral Hepatitis, Sexually
Transmitted Disease, and Tuberculosis Programs: Standards to Facilitate Sharing and Use of Surveillance
Data for Public Health Action.
All staff responsible for the transmission and receipt of HIV surveillance data and MHS nucleotide
sequence data must be trained in the security and confidentiality procedures for HIV surveillance.

Collecting antiretroviral use history data for all newly diagnosed persons
Information on the prior use of ARVs for all newly diagnosed persons is needed to estimate the prevalence
of total HIV drug resistance, including transmitted drug resistance-associated mutations (TDRMs). MHS
areas can collect ARV use history data using the CDC Adult HIV Confidential Case Report Form or other
forms (e.g., state-based case report forms or National HIV Monitoring and Evaluation Program [NHM&E]
form). Sources of the information may be patient self-reports; medical charts that contain physician’s notes,
laboratory reports, and pharmacy records; and the AIDS Drug Assistance Program (ADAP) records. Staff
reporting ARV use data should comply with the jurisdiction’s standard reporting procedures or other
procedures that meet the routine security and confidentiality guidelines for HIV surveillance.
Information on ARV use should be entered into eHARS on the Testing and Treatment History (TTH)
Document. To be consistent with the principles of document-based data entry, new eHARS documents
should be used to enter data from multiple forms, from multiple sources, or to update previously entered
information.
Information for all variables should be collected as close as possible to the HIV diagnosis date to identify
persons with evidence of prior ARV use. The TTH variables related to ARV use in eHARS are listed below.


Ever Taken Any Antiretroviral Medications ― this variable is used to determine whether the
patient took any ARVs at any time. The information collected should indicate whether
antiretroviral drugs have ever been used (i.e., no time limit should be placed on the history of
antiretroviral drug use) and the date on which that information was obtained.



Name(s) of ARV Medication Taken ― this variable lists at least one of the ARVs that the patient

Cleared by HICSB Management 10/15/2012

has taken, but may not include all medications used, and verifies that at least one medication taken
was an ARV. A list of current medications used to treat HIV is available at
http://www.aidsinfo.nih.gov/ContentFiles/AdultandAdolescentGL.pdf.


Date ARVs First Began ― this date represents the earliest date of any ARV use and determines
whether the patient took any ARVs before the collection date of the specimen from which the
nucleotide sequence was obtained.



Date of Last ARV Use ― this variable represents the date when ARVs were last taken by the
patient.

Additional information about the collection of ARV use history data and entry of these data into eHARS
can be found in the Guidance for Collection and Data Entry of HIV Incidence Surveillance Information.

Reviewing state or local HIV laws and regulations regarding the reporting of HIV nucleotide
sequence data
MHS areas should review existing state laws and regulations regarding the reporting of HIV test results
to the health department. If HIV nucleotide sequence data are not specifically referenced on the list of
reportable HIV laboratory test results, areas should consult the state office of legal counsel to determine
whether current laws and regulations can be interpreted to include the reporting of HIV nucleotide
sequence data (e.g., “all tests indicative of HIV infection and care”). Otherwise, areas should consider
modifying existing laws and regulations to ensure the reporting of HIV nucleotide sequence data for
public health surveillance.
Additional information about reviewing reporting laws is available in the chapter on Reporting in the
Technical Guidance for HIV Surveillance Programs, Volume I: Policies and Procedures.

Collaborating with laboratories performing HIV genotype testing
MHS relies on collaboration with laboratories performing HIV genotype testing. Each area should identify
public, commercial, and private laboratories that perform HIV genotype testing for area residents. Sources
of this information include Clinical Laboratory Improvement Amendments (CLIA) state and regional
offices and state and local licensing boards for clinical laboratories.
Areas should consider developing a survey to collect information that will facilitate collaboration between
the laboratories and the health department. Examples of topics to be addressed include the following:


Contact information for key laboratory personnel, both administrative and technical

Cleared by HICSB Management 10/15/2012



Whether HIV genotype testing occurs on-site or at a reference laboratory, and document how their
HIV genotype testing system can generate and export nucleotide sequence data in standard
text-based file formats



Level of information technology (IT) support available

Laboratory staff should be informed about the purpose of MHS and made aware of any laws or regulations
that require the reporting of HIV nucleotide sequence data to the health department, and encouraged to
partner with the health department to conduct MHS activities.
Additional information about laboratories and reporting of data is available in the chapter on Reporting in
the Technical Guidance for HIV Surveillance Programs, Volume I: Policies and Procedures.

Obtaining HIV nucleotide sequence data for persons newly diagnosed with HIV infection and
persons living with HIV infection who had HIV genotype tests done
MHS sites should work with commercial and private laboratories to obtain all HIV nucleotide sequence
data, regardless of the person’s date of diagnosis. In other words, collection of HIV sequence data should be
collected for all persons diagnosed and living with HIV, not just for those who are newly diagnosed, who
had HIV genotype tests done.
Laboratories that perform HIV genotype testing use HIV genotyping systems to analyze HIV nucleotide
sequence data. The primary output of most of these systems is a genotype report that provides a drug
resistance interpretation for clinical use. The HIV nucleotide sequence, which is the basis of MHS
activities, is an intermediate product of these HIV genotype testing systems. MHS areas should work with
laboratory staff to develop procedures for extracting HIV nucleotide sequence data from the HIV genotype
testing system. Sequence data are often not stored with other laboratory test results, and the HIV genotype
testing system that holds the sequence data may not be connected to the laboratory’s main computer
network. Procedures should also be developed that link the sequence data to standard patient demographic
information and other data (e.g., collection date, ordering physician). Additional linking procedures may be
necessary if a reference laboratory is used to conduct the HIV genotype testing, as the reference laboratory
may not have access to standard patient and provider data available.
Close collaboration with the laboratory administration and technical staff, including IT staff, is needed to
extract the HIV nucleotide sequence data from HIV genotype testing systems. If the laboratory staff are not
familiar with the data export capabilities of the genotyping system, the manufacturer of the HIV genotype
Cleared by HICSB Management 10/15/2012

testing system should be consulted.
MHS areas should determine the best method for receiving HIV nucleotide sequence data files from
laboratories performing the HIV genotype testing. MHS areas should work with the laboratory staff to
determine a standard file format (HL7 messaging, FASTA, ASCII, .txt) that will be used to transmit the
HIV nucleotide sequence data and relevant information from the laboratories to the health department.
Depending on the surveillance program’s infrastructure, technical capabilities, and state reporting laws and
regulations, programs might rely on a combination of the methods described below.

Electronic Laboratory-based Reporting (ELR)
Electronic Laboratory Reporting (ELR) is the electronic transfer of public health data from clinical
laboratories to public health agencies in pre-established formats (e.g., HL7 messaging, ASCII, spreadsheet)
that do not require extensive human manipulation, such as data entry, cutting and pasting, or translation to
add to a database. Ideally, data transmitted by ELR should be automated and should use standardized codes
for tests (e.g., Logical Observation Identifiers Names and Codes or LOINC) and results, allowing for
timely, complete, and accurate reporting. Additional information about ELR is available in the chapter on
Reporting of the Technical Guidance for HIV Surveillance Programs, Volume I: Policies and Procedures.
Possible methods of receiving HIV nucleotide sequence data from laboratories include coordinated
transmission with HIV case surveillance data, coordinated transmission with data from existing state
systems, and transmission of sequence data from the laboratory directly using the Secure File Transfer
Protocol (SFTP).
Transmission with HIV case surveillance data
Many HIV surveillance programs that use ELR to receive HIV serology data, CD4 data, and viral load data,
may receive HIV nucleotide sequence data through this same mechanism. If the HIV surveillance program
does not use ELR, other surveillance programs within the health department (e.g., general infectious
diseases, TB, STDs) may use ELR to receive HIV nucleotide sequence data. MHS staff should consult with
staff within these programs and with IT staff at the health department about the possibility of modifying
existing ELR processes that ensure the secure and confidential receipt of HIV nucleotide sequence data.
Transmission through existing state systems
The CDC Public Health Information Network (PHIN) is a national initiative to improve the capacity of
public health to use and exchange information electronically by promoting the use of standards and
defining functional and technical requirements. As a component of PHIN, CDC has developed the National
Cleared by HICSB Management 10/15/2012

Electronic Disease Surveillance System (NEDSS), an Internet-based infrastructure for public health
surveillance data exchange. The NEDSS Messaging solution (NMS) supports electronic messaging
between public health partners (e.g., commercial entities and local, state, and federal agencies) and relies
heavily on industry standards (i.e., LOINC, SNOMED, and HL7), policy-level agreements on data access,
and the protection of confidentiality.
MHS areas that are considering receiving HIV nucleotide sequence data through their state NEDSS
program should coordinate with NEDSS program staff to make modifications in NEDSS. Upon meeting
security and confidentiality guidelines, HIV nucleotide sequence data can be routed through NEDSS to the
MHS program. Sites that have implemented a system that uses standards similar to NEDSS or have
mobilized healthcare information electronically across different organizations through health information
exchanges (HIE) can also consider the possibility of receiving HIV surveillance data via these mechanisms.
Additional information about NEDSS and HIE are available in the chapter on Reporting of the Technical
Guidance for HIV Surveillance Programs, Volume I: Policies and Procedures.
Transmission using Secure File Transfer Protocol (SFTP)
A common method used by health departments to receive HIV surveillance data is the Secure File Transfer
Protocol (SFTP). SFTP is a type of protocol that provides a set of rules that govern the syntax, semantics,
and synchronization of communication across computer networks. SFTP encrypts both commands and
data, requires certification on at least the sending or receiving end, and allows the secure transmission of
passwords and sensitive information.
To establish SFTP transmission, both the host laboratory and the health department should maintain a SFTP
server, preferably located within a secure area, behind a firewall, and with other physical security measures
to prevent access by non-authorized staff. Authorized staff at the health department may be granted
permission to log into a laboratory’s host network, access the host server using a password, retrieve the
sequence data files (e.g., HL7 file or FASTA file) and initiate the transfer of the files from the laboratory to
a SFTP server located at the health department. Alternatively, the health department may grant permission
for authorized laboratory staff to access and transfer the data files to the secure server at the health
department. Regardless of the process chosen, close collaboration between the laboratory staff, MHS staff,
and staff from both IT departments is essential.

Cleared by HICSB Management 10/15/2012

Ideally, electronic data transfers should be conducted over a secure data network (SDN), virtual private
network (VPN) connection with certificates on both the sending and receiving ends, or a similar secure
connection. At a minimum, when transferring data electronically, programs should encrypt data using a
secure application such as the SFTP described above. If either the sender or the recipient of the data is not
part of a defined security zone appropriate for sensitive data, the data should also be encrypted by another
method prior to being transmitted.
MHS areas that have not yet implemented ELR are strongly encouraged to do so, particularly for the
collection of HIV nucleotide sequence data. Areas should contact their assigned CDC HIV Incidence and
Case Surveillance Branch epidemiologist and request assistance in establishing ELR for their HIV
surveillance program. Refer to the ELR section in the chapter on Reporting of the Technical Guidance for
HIV Surveillance Programs, Volume I: Policies and Procedures.

Non-ELR methods
If ELR is not a feasible option, MHS areas can develop other methods of obtaining HIV nucleotide
sequence data from the laboratory to the health department. Acceptable methods include using CDs, DVDs,
or FIPS 140-2 compliant flash drives or external hard drives, provided that these portable and external
storage components have encryption software that meets the federal Advanced Encryption Standards
(AES). The selected procedures should also comply with security and confidentiality requirements at the
state and CDC.
All removable or external storage devices containing identifiable public health data must include only the
minimum amount of information necessary to accomplish assigned tasks as determined by the designated
official or overall responsible party (ORP); must be encrypted or stored under lock and key when not in use;
and must be sanitized immediately following a given task (except for those used as back-ups). Methods
used to sanitize a storage device must ensure that any data on the device cannot be retrieved by using
“undelete” or data retrieval software.

Storing and validating HIV nucleotide sequence data
Because the Laboratory Document in eHARS does not currently accommodate HIV nucleotide sequence
data, MHS areas should develop procedures for processing and managing the data. Through the NEDSS
program, CDC has provided most funded health departments with the Rhapsody Integration Engine (Orion
Health, CA), a software tool that can be used to read laboratory data in various formats. MHS areas using
Cleared by HICSB Management 10/15/2012

ELR methods can use this CDC-provided software, or an alternative software, to parse laboratory data
reported through ELR and translate the laboratory results into a format that can be imported into a database
or repository. All areas should develop processes for importing the data into a local MHS database,
exporting these data from the MHS database, and using SAS software to merge these data with
CDC-specific demographic and clinical variables from eHARS.
Until sequence data can be imported into eHARS, MHS areas should develop or modify a database that can
hold a large volume of data (e.g., SQL database). At a minimum, the database should include a unique
record ID (e.g., MHSID), STATENO, patient information, laboratory CLIA number, accession number,
unique specimen ID, LOINC, specimen collection date, facility information, provider information, and HIV
nucleotide sequence(s). Inclusion of LOINC is important to distinguish the type of HIV nucleotide
sequence generated by the HIV genotype test. The data may exist as two separate nucleotide sequences
from the PR and/or RT genes of the pol region, and the data may also exist as a single, combined PR and RT
sequence. The paired vs. single-record format of the result depends on the genotyping system used by the
laboratory performing the test. Though rare, the data may also represent the integrase gene of the pol region,
and sequences may exist as separate or combined PR, RT, and integrase sequences.
Sequences should be stored in the database in their original format. Therefore, nucleotide sequences that are
received as separate records should be stored as separate laboratory results for the same individual. The
sequences can be concatenated during data analysis.
Data validation should be implemented to ensure that the data received and stored are reasonable. Reported
nucleotide sequences vary in length among and within laboratories, and MHS areas should be able to
identify potential problems. Protease sequences contain at most 297 base pairs and RT sequences contain at
most 1,320 base pairs, for a combined protease-RT length of 1,617 possible base pairs. Integrase sequences
contain at most 866 base pairs.
MHS areas should develop internal processes for validating the sequences, including:


Using LOINC to compare the length of sequences received to expected lengths. Though length
sequences vary according to the HIV genotyping system used, sequences outside of the system’s
expected length or outside of a laboratory’s usual range of variation may indicate a problem with
transmission.



Assessing sequences for embedded, non-sequence characters. Some characters may be legitimate,
while others are not and may interfere with proper interpretation of the sequence. Sequences that

Cleared by HICSB Management 10/15/2012

contain numbers, letters other than ATUCGNRWYMKSHBVDX, and/or punctuation other than
~!#*-.()' might indicate a problem.

Linking HIV nucleotide sequence data with case surveillance information
Once the nucleotide sequence data have been validated, the data should be linked with case surveillance
information. MHS areas should develop processes for merging the sequence data with selected
demographic and clinical data from eHARS using the SAS software and storing the linked data. Unmatched
sequence data may indicate a reporting delay in eHARS or may indicate a new case that has not been
reported to the HIV surveillance system; additional follow-up or field investigation of the case may be
warranted. Appendix B lists the minimum set of data elements required to meet MHS objectives.

Ongoing monitoring of data quality and evaluation of local data
MHS areas should review the minimum set of data elements (Appendix B) and determine the completeness
and quality of the data elements used for analysis. Because all of the demographic and clinical data
elements used are key elements for HIV case surveillance, areas should consider methods of increasing the
reporting of these elements (e.g., adding specific elements, such as country of birth, to counseling and
testing laboratory request forms).

Preparing monthly data sets and transferring them to CDC
Until the Laboratory Document in eHARS can accommodate HIV nucleotide sequence data, MHS areas are
expected to transmit a complete MHS dataset (sequence data merged with eHARS data) to CDC before the
15th day of the next month via the SDN. Data transmitted to CDC must be encrypted and password
protected and must not include personal identifiers as specified in Data Security and Confidentiality
Guidelines for HIV, Viral Hepatitis, Sexually Transmitted Disease, and Tuberculosis Programs: Standards
to Facilitate Sharing and Use of Surveillance Data for Public Health Action. All MHS areas must have
encryption software and a CDC-approved SDN certificate. Symantec PGP Desktop Professional 10.2 is
currently the preferred encryption product for CDC. If PGP is used, all staff should create
password-protected, self-decrypting files or exchange encryption keys.
To track the quality of MHS data, area-specific reports are generated by the CDC MHS Data Manager on a
monthly basis and shared with MHS areas via the SDN.

Analyzing data, including transmitted drug resistance
CDC uses a regularly updated program to analyze the HIV nucleotide sequence data submitted by
Cleared by HICSB Management 10/15/2012

genotyping laboratories. HIV-1 pol sequences are screened for subtype B (cut-off 90%) and potential non-B
variants using Sierra—The Stanford HIV Web Service, Version 1.0
(http://hivdb.stanford.edu/pages/webservices/). This program translates the nucleotide sequence data and
incorporates information on individual mutations of interest, the level of resistance to each antiretroviral
drug in common use, and HIV-1 subtype. Sequences classified to potential non-B variants are
phylogenetically assigned to subtypes, CRFs, and URFs. Records that meet CDC data quality are
aggregated for national analyses, including analyses on transmitted drug resistance-associated mutations
(TDRMs).
Persons are classified as having sequences that contain transmitted drug resistance-associated mutations
(TDRMs) based on the CDC HIV-1 surveillance mutation list if the following criteria are met:


The nucleotide sequence is from a specimen that was drawn within three months after the date of
collection of the diagnostic specimen (i.e., the HIV-positive specimen that led to the report in
eHARS).
and



The person has no evidence of prior ARV use (as determined by ARV history use data).

On a semi-annual basis or as deemed appropriate, CDC will provide a local dataset and accompanying SAS
program for MHS areas to conduct local data analyses. Alternatively, MHS areas that have staff with
knowledge of Perl, Java, and XML can choose to process the sequence data reported from laboratories by
installing and using the Sierra Web service (or a similar service meeting security and confidentiality
guidelines). Staff should also have advanced SAS skills to locally develop their own SAS programs to read
in outputs from processed sequences, apply surveillance mutation lists, and analyze the data.

Developing and disseminating data reports and presentations
As appropriate, results of national data analyses will be presented at conferences and published in
peer-reviewed journals. Contributors representing the surveillance areas and those representing CDC will
be determined for each presentation or paper. MHS areas should also disseminate the results of local
analyses through surveillance reports and presentations to assist HIV treatment, prevention, and program
planning and evaluation.

OUTCOME STANDARDS
Outcome standards described in the Introduction to Policies and Procedures, Data Quality, and Reporting
chapters of Technical Guidance for HIV Surveillance Programs, Vol. I: Policies and Procedures should be
Cleared by HICSB Management 10/15/2012

applied to MHS. Meeting the surveillance standards for case ascertainment, data quality, timeliness, and
completeness are essential to the success of MHS. The outcome standards for MHS relate only to persons
who resided in the surveillance area at the time of diagnosis.
For assessment at 12 months after the end of the diagnosis year,


At least 50% of newly diagnosed HIV disease cases reported to the national HIV surveillance
system for a calendar year should have an initial HIV nucleotide sequence from a specimen
obtained within 3 months of HIV diagnosis, and



At least 85% of newly diagnosed HIV disease cases with a nucleotide sequence reported to the
national HIV surveillance system for a calendar year should have HIV treatment history data.

Cleared by HICSB Management 10/15/2012

REFERENCES
1. Centers for Disease Control and Prevention. Vital Signs: HIV Prevention through Care and Treatment
— United States. MMWR 2011;60:1618-1623. Accessed 2012 Mar 12.
2. Ocfemia MCB, Kim D, Ziebell R, Prejean J, Saduvala N, Pieniazek D, Heneine W, Kline, Hall IH.
Prevalence and Trends of Transmitted Drug Resistance-associated Mutations by Duration of Infection
among Persons Newly Diagnosed with HIV-1 Infection: 5 States and 3 Municipalities, US, 2006 to
2009. Available at http://www.retroconference.org/2012b/PDFs/730.pdf. Accessed 2012 Mar 12.
3. Panel on Antiretroviral Guidelines for Adults and Adolescents. Guidelines for the use of
antiretroviralagents in HIV-1-infected adults and adolescents. Department of Health and Human
Services. October 14, 2011; 1–167. Available at
http://www.aidsinfo.nih.gov/ContentFiles/AdultandAdolescentGL.pdf.Accessed 2011 Dec 15.
4. Hirsch MS, Gϋnthard HF, Schapiro JM, Brun-Vézinet F, Clotet B, Hammer SM, et al. Antiretroviral
drug resistance testing in adult HIV-1 infection: 2008 recommendations of an International AIDS
Society–USA Panel. Clin Infect Dis. 2008 Jul 15;47(2):266-85.

SUGGESTED READINGS









Wheeler W, Ziebell R, Zabina H, Pieniazek D, Prejean J, Bodnard U, et al. Prevalence of transmitted
drug resistance-associated mutations and HIV-1 subtypes in new HIV-1 diagnoses, U.S.–2006. AIDS.
2010 May 15;24(8):1203-12.
Cohen MS, Chen YQ, McCauley M, Gamble T, Hosseinipour MC, Kumarasamy N, et al. Prevention of
HIV-1 infection with early antiretroviral therapy. N Engl J Med. 2011 Aug 11;365(6):493–505.
Pieniazek D, Ziebell R, Kline R, Prejean J, Hall I. Evaluation of Using Dried Fluid Spots for HIV-1
Drug Resistance Genotyping in the United States. Presented at: 2011 National HIV Prevention
Conference; 2011 Aug 14–17; Atlanta, GA. Available at
http://www.2011nhpc.org/archivepdf/2011%20NHPC%20Final%20Abstract%20Book.pdf.
Pieniazek D, Ziebell R, Ocfemia CB, Saduvala N, Kline R, Prejean J, Kim D, Hall HI. Phylogenetic
Surveillance of HIV-1 non-B Subtypes among HIV-1 New Diagnoses, United States, 2006-2008.
Presented at: 2011 National HIV Prevention Conference; 2011 Aug 14–17; Atlanta, GA. Available at
http://www.2011nhpc.org/archivepdf/2011%20NHPC%20Final%20Abstract%20Book.pdf.
Pieniazek, D, Ziebell R, Ocfemia MCB, Saduvala N, Kline R, Prejean J, Kim D, Hall HI. Phylogenetic
surveillance of HIV-1 non-B subtypes among U.S.-born and foreign-born individuals living in the
United States revealed similar viral genetic diversity but different race and male transmission patterns.
Poster session presented at: 19th Conference on Retroviruses and Opportunistic Infections; 2012 Mar
5–8; Seattle, WA. Available at http://www.retroconference.org/2012b/PDFs/516.pdf.

Cleared by HICSB Management 10/15/2012

Notes

Cleared by HICSB Management 10/15/2012

APPENDIX A
National Center for HIV, STD, and TB Prevention’s Non-research Determination for HIV

Cleared by HICSB Management 10/15/2012

APPENDIX B
MHS Data Elements
The following surveillance data elements are used to estimate the prevalence of HIV-1 drug resistance and
distribution of HIV-1 subtypes in the United States.
HIV-1 Drug Resistance
Prevalence

HIV-1 Subtype
Distributions

Age

X

X

Sex

X

X

Race/ethnicity

X

X

Transmission category for HIV infection

X

X

Country of origin

X

X

Current state of residence

X

X

State of residence at HIV diagnosis

X

X

Data Element
Demographic Data

Laboratory Data
Specimen collection date associated with
nucleotide sequence
HIV pol gene nucleotide sequence data

X

X

X

X

Mutation-specific assays

X

X

Previous HIV Testing Data
Date of first HIV test
Date of first positive HIV test
(documented or self-reported)
Date of last negative HIV test
(documented or self-reported)

X
X
X

Clinical Data
Date of HIV diagnosis

X

Date of AIDS diagnosis

X

CD4 counts

X

Dates of CD4 counts

X

Viral load

X

Dates of viral loads

X

Antiretroviral agents used

X

Start/end dates of antiretroviral agent use

X

Opportunistic infection(s) diagnosed

X

Date(s) of opportunistic infection diagnosis

X

Cleared by HICSB Management 10/15/2012

APPENDIX C
History and Timeline of MHS
2002: CDC funds four surveillance areas to conduct the Antiretroviral Drug Resistance Testing
(ARVDRT) pilot project, which demonstrates the feasibility of using remnant sera from diagnostic
testing to conduct HIV genotypic resistance testing.
2004: Through a four-year cooperative agreement, 22 CDC-funded HIV Incidence Surveillance (HIS)
areas opt to also conduct Variant, Atypical, and Resistant HIV Surveillance (VARHS) using a
protocol developed under ARVDRT.
CDC determines that VARHS is a non-research disease surveillance activity that does not require
institutional review board approval or informed consent.
2007: CDC publishes first VARHS data in abstract presented at the 2007 Conference on Retroviruses and
Opportunistic Infections.
2008: Through a five-year cooperative agreement, CDC funds 11 surveillance areas to conduct VARHS
using the protocol developed in 2004.
CDC establishes a contract with the Stanford Clinical Virology Laboratory at Stanford University
Medical Center (Palo Alto, CA) to conduct genotypic resistance testing for VARHS.
2009: CDC adapts the WHO global HIV-1 surveillance mutation list developed for interpreting
transmitted drug resistance-associated mutations (TDRMs) for all HIV-1 subtypes and finalizes the
CDC HIV-1 surveillance mutation list for evaluating the prevalence of TDRMs for subtype B, the
predominant HIV-1 subtype in the United States.
2010: CDC publishes first VARHS analysis in peer-reviewed journal. (AIDS. 2010 May 15; 24(8):120312.)
2011: CDC does not renew the contract with the Stanford Laboratory and discontinues genotypic
resistance testing through this laboratory. Genotypic resistance testing for VARHS transitions to a
program reliant on VARHS-funded sites to collect nucleotide sequence data from commercial and
private laboratories.
2012: CDC proposes expanding VARHS to include the use of molecular epidemiology approaches to
describe the burden of HIV infection and supplement other HIV surveillance data. The VARHS
program is renamed Molecular HIV Surveillance (MHS) to reflect these broader goals and
objectives.
CDC also proposes expanding VARHS to include the collection of (1) ARV history use data for all
new diagnoses of HIV infection and (2) nucleotide sequence data for all persons diagnosed with
HIV infection, regardless of when the person was diagnosed or when the specimen (from which the
sequence was obtained) was collected.

Cleared by HICSB Management 10/15/2012

APPENDIX D
Glossary of Terms (unless otherwise noted, terms are limited to HIV)
Antiretroviral drug: a medication used to treat HIV infection and prevent HIV transmission.
Antiretroviral therapy: a combination of antiretroviral drugs administered consistently and
therapeutically to treat HIV. It does not cure HIV infection, but controls HIV reproduction and transmission
and boosts the immune system of the person in treatment.
Circulating recombinant form (CRF): an HIV strain with a mosaic structure of the genome consisting of
two or more distinct subtypes that have been identified in at least three individuals who do not have direct,
epidemiologically-linked infections. As of May 2012, 51 CRFs have been identified globally.
Drug resistance: the ability of HIV to continue to reproduce in the presence of antiretroviral drugs. Drug
resistance can be acquired after exposure to antiretroviral drugs or transmitted from an HIV-infected
person.
Drug resistance testing: testing the blood plasma of HIV-infected individuals to identify HIV drug
resistance. Commonly used drug resistance tests include genotypic resistance testing (genotyping),
phenotypic drug resistance testing (phenotyping), and virtual phenotypic drug resistance testing.
Enhanced HIV/AIDS Reporting System (eHARS): a browser-based HIV surveillance system deployed
at state and local health departments. The data are collected in documents such as case reports, lab reports
and death certificates. The health departments submit de-identified data electronically on a monthly basis to
CDC’s national database through a secure data network.
Electronic laboratory-based reporting (ELR): the electronic transfer of public health data from clinical
laboratories to public health agencies in pre-established formats that do not require extensive human
manipulation to add to a database. HL7 messaging is an example ELR format.
FASTA file: a standard, text-based format for nucleotide sequences. Each nucleotide sequence is preceded
by a line starting with > and a description or name. Base pairs or amino acids are represented using
single-letter codes.
Example:
>HumanATGGCACATGCAGCGCAAGTAGGTCTACAAGACGCTACTTCCCCTATCATAG
AAGAGCTTATCACCTTTCATGATCACGCCCTCATAATCATTTTCCTTATCTGCTTCCTA
Genotypic resistance testing: testing the blood plasma of HIV-infected individuals to detect the presence
of mutations associated with drug resistance. Genotypic resistance assays compare the nucleotide
sequences (e.g., the protease and reverse transcriptase genes of the pol region) of the infected person with a
wild-type strain.
Health Information Exchange (HIE): the mobilization of healthcare information electronically across
organizations within a region, community or hospital system. HIE provides the capability to electronically
move clinical information among disparate health care information systems while maintaining the meaning
Cleared by HICSB Management 10/15/2012

of the information being exchanged. The goal of HIE is to facilitate access to and retrieval of clinical data to
provide safer, more timely, efficient, effective, patient-centered care.
HL7 messaging: a standard method of electronically transmitting laboratory results.
Molecular epidemiology of HIV: the application of molecular biology techniques (e.g. polymerase chain
reaction-PCR, phylogenetic analyses of viral sequences) for the detection, characterization, and
transmission of HIV to study the distribution and determinants of disease occurrence and health-related
events in the human population.
Mutation: a genetic change that results in a viral strain that is different from the wild-type HIV strain.
Mutations can occur naturally or in the presence of antiretroviral drugs. A mutation is described by a
combination of letters and numbers (e.g., M41L). The first letter (M) represents the amino acid in the
wild-type strain, the number (41) represents the amino acid position in the gene, and the last letter (L)
represents the mutation.
Nucleotides: molecules that make up the structural basis of nucleic acids, such as DNA or RNA. Each
nucleotide consists of a phosphate group, a sugar (ribose in RNA), and a set of nucleotide bases: adenine
(A), cytosine (C), guanine (G), and thymine (T). Three nucleotides make up a codon, which represent a
single amino acid, the building blocks of proteins.
Nucleotide sequence: the genetic code of nucleic acids (i.e., DNA and RNA).
Phylogenetic analysis: the process of studying the relationship between HIV strains through analysis of
nucleotide sequences. Phylogenetic methods are used to detect closely related HIV strains (i.e., clusters)
and graphically display them through phylogenetic trees.
Polymorphism: a genetic mutation that occurs naturally in the absence of antiretroviral drugs.
Recombinant form: a hybrid HIV strain created when two or more HIV strains of different subtypes are
combined. See circulating recombinant form and unique recombinant form.
Secure data network (SDN): method of transmitting data across defined, secure boundaries.
Secure file transfer protocol (SFTP): a type of protocol that provides a set of rules that govern the syntax,
semantics, and synchronization of communication across computer networks. SFTP encrypts both
commands and data, requires certification on the sending or receiving end, and allows the secure
transmission of passwords and sensitive information.
Transmitted HIV drug resistance: the transmission of a drug-resistant HIV strain from an infected
person to an uninfected person, resulting in HIV drug resistance in the newly infected, drug-naïve person.
The presence of mutations associated with transmitted drug resistance (i.e., transmitted drug-resistance–
associated mutations, TDRMs) can be detected through genotypic resistance testing.
Transmitted drug resistance-associated mutations: HIV mutations that confer antiretroviral drug
resistance.

Cleared by HICSB Management 10/15/2012

Unique recombinant form (URF): a hybrid strain that is the result of recombination of two or more HIV
subtypes that has not been identified elsewhere.
Viral load: an estimate of the amount of virus in an infected person’s blood. For clinical HIV management,
it is typically expressed as the number of HIV RNA copies calculated per milliliter of blood plasma.
Wild-type strain: an HIV strain that has not been exposed to antiretroviral drugs.

Cleared by HICSB Management 10/15/2012

APPENDIX E
Acronyms
ACRF
AES
AIDS
ART
ARV
ARVDRT
ASCII
CDC
CD4
CLIA
CRF
CROI
DFS
DHAP
eHARS
ELR
HICSB
HIS
HIV
IAS-USA
INSTI
IRB
LOINC
MHS
NCHHSTP
NEDSS
NNRTI
NRTI
ORP
PHIN
PI
S&C
SDN
SFTP
TDRM
TTH
URF
VARHS
VL
VPN

Adult HIV Confidential Case Report Form
Advanced Encryption Standard
Acquired Immunodeficiency Syndrome
Antiretroviral therapy
Antiretroviral
Antiretroviral Drug Resistance Testing
American Standard Code for Information Interchange
Centers for Disease Control and Prevention
Cluster of differentiation 4
Clinical Laboratory Improvement Amendments
Circulating Recombinant Form
Conference on Retroviruses and Opportunistic Infections
Dried fluid spots
Division of HIV/AIDS Prevention
Enhanced HIV/AIDS Reporting System
Enhancing Laboratory Reporting, Electronic laboratory reporting
HIV Incidence and Case Surveillance Branch
HIV Incidence Surveillance
Human Immunodeficiency Virus
International Antiviral Society-USA
Integrase strand-transfer inhibitor
Institutional Review Board
Logical Observation Identifiers Names and Codes
Molecular HIV Surveillance
National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention
National Electronic Disease Surveillance System
Non-nucleoside reverse transcriptase inhibitor
Nucleoside reverse transcriptase inhibitor
Overall responsible party
Public Health Information Network
Protease inhibitor
Security and confidentiality
Secure data network
Secure file transfer protocol
Transmitted drug resistance-associated mutation
Testing and treatment history
Unique recombinant form
Variant, Atypical, Resistant HIV Surveillance
Viral load
Virtual private network

Cleared by HICSB Management 10/15/2012

The Molecular HIV Surveillance chapter of the Technical Guidance for HIV Surveillance Programs was
revised and reviewed by staff within the CDC HIV and Incidence Case Surveillance Branch and the
following health departments: Rory Angulo (Connecticut), Mary-Grace Brandt (Michigan), Mariama
Gondo (Florida), Dan Gordon (New York), Tom Jaenicke (Washington), Michelle Porter (Texas), and
Lucia Torian (New York City).

Cleared by HICSB Management 10/15/2012